taniacarey1181 taniacarey1181

21-01-2021
Biology

contestada

There are two types of local winds. Sea breezes blow during the day from a body of water toward land,
whereas Land breezes occur at night and blow from the land to a body of water. Unequal heating is
causing the changes in pressure due to the fact that
warms and cools faster than

There are two types of local winds Sea breezes blow during the day from a body of water toward land whereas Land breezes occur at night and blow from the land t class=

Respuesta :

plants93729 plants93729

21-01-2021

I think the answer might be

Water, Land

I might be able to help better if I know the name of the unit your on?

Answer Link

Otras preguntas

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid 5’ agcgggatgagcgcatgtggcgcataa

Antonio's coworkers know a lot about motorcycles. He is trying to learn from them, so he will be an expert, too. For Antonio, what role do his coworkers fill?

A child bus ticket costs $0.40 and an adult’s ticket costs $0.70. A group of 11 individuals pays $5.90 for their fare. Quantity A The number of children Quantit

The good show ticket agency offered 20,000 tickets for an outdoor concert. They sold 17,343 tickets. The concert was rained out near the end. As a result, 1239

PLEASE HELP! Will give brainliest answer for the right answer! ||| The specific types and sequence of amino acids determine the structure and function of which

What is the challenge willy face in expert from stone fox

In the course of normal events leading to fertilization and eventually birth, the route of the egg, embryo, and finally fetus is from the ovary into the _______

I need to know the area of the shape base 1 (27ft) base 2(34ft) Height (12ft)

Graph p>−1.6 on a number line.

the radius of s cylinder is 3x-2cm the height of the cylinder is x+3 cm what is the surface area of the cylinder