mariamariaaa775
mariamariaaa775 mariamariaaa775
  • 30-12-2020
  • English
contestada

what good qualities have you inherited from your parents​

Respuesta :

danielmoralespizarro
danielmoralespizarro danielmoralespizarro
  • 30-12-2020

Answer:

AKSJJAKKJS

Explanation:

*se rie*

Answer Link

Otras preguntas

When choosing a candidate for political office, which organizational pattern do voters use? a. compare/contrast b. cause/effect c. fact/opinion d. problem/solu
Which one of the following events in "Bernice bobs her hair" is an example of an epiphany
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
2.38 rounded to the nearest whole number?
What does it mean to say, Defend their will, if their going on trial or to court? (Im trying to see if it will make sense with the paragraph I'm writing for soc
Phillip saves $8each month. How many months will it take him to save at least $60.
in this paragraph. at what time of day is the action taking place
If the perimeter of a rectangle is 60cm how do I form an equation and solve it to find x?
washington, D.C is _ of ottawa
China grew very wealthy mainly as a result of what