kayveonjefferson kayveonjefferson

02-12-2020
History

contestada

why did some other indigenous peoples dislike the Aztec Empire? *

Respuesta :

rpadilla0039 rpadilla0039

02-12-2020

Answer:

Because the Aztecs were ruthless and very cruel.

Explanation:

I searched it up <3

Answer Link

Otras preguntas

PLEASE HELPPPP Give some examples of a scientific model. What are some benefits and limitations of using models.

PLEASE, HELP ME!!what did unions accomplish. 1.2.3.4.

what is the mrna of tacgggcctatacgctactactggatc

Why is it difficult to tap Siberia’s resources?

Which statement about Portugal is not true?

Infected cells can release chemicals that travel through the bloodstream to alert the brain. The brain then sends signals along [veins; muscles; nerve cells; bo

Which property is illustrated by the following statement? If zxy=fde

find missing number. show work. 120-35=100-?=60+?

Which quantity is proportional to 65⁄5? Check all that are true. 13⁄1 260⁄10 195⁄15 130⁄15 130⁄10

Name the 3 main Anglo-Saxon earldoms