kayveonjefferson kayveonjefferson
  • 02-12-2020
  • History
contestada

why did some other indigenous peoples dislike the Aztec Empire? *

Respuesta :

rpadilla0039
rpadilla0039 rpadilla0039
  • 02-12-2020

Answer:

Because the Aztecs were ruthless and very cruel.

Explanation:

I searched it up <3

Answer Link

Otras preguntas

PLEASE HELPPPP Give some examples of a scientific model. What are some benefits and limitations of using models.
PLEASE, HELP ME!!what did unions accomplish. 1.2.3.4.​
what is the mrna of tacgggcctatacgctactactggatc​
Why is it difficult to tap Siberia’s resources?
Which statement about Portugal is not true? ​
Infected cells can release chemicals that travel through the bloodstream to alert the brain. The brain then sends signals along [veins; muscles; nerve cells; bo
Which property is illustrated by the following statement? If zxy=fde
find missing number. show work. 120-35=100-?=60+?​
Which quantity is proportional to 65⁄5? Check all that are true. 13⁄1 260⁄10 195⁄15 130⁄15 130⁄10
Name the 3 main Anglo-Saxon earldoms