Seudónimo Seudónimo
  • 17-11-2020
  • Mathematics
contestada

what is half of 37
and you will get
brainliest answer

Respuesta :

cfyij856 cfyij856
  • 17-11-2020

Answer:

18.5 Pls mar me brainliest

Step-by-step explanation:

Answer Link

Otras preguntas

__________ is widely considered to be the founder of the professional american police department.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
the influence of Greek and Roman culture on some Renaissance art is reflected in what
Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?
PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single
Choose all that apply. Melinda finds that she does not like taking risks with her money. Which of the following would you recommend for her? Collectibles stock
Write the polynomial in standard form. then name the polynomial based on its degree and number of terms.2 – 11x2 – 8x + 6x2
describe five ways to set strategy for effectively gathering patients information
Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9
Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income