student166270 student166270

17-11-2020
Mathematics

contestada

The flagpole in front of Silver Pines Elementary School is 18.375 feet tall. What is 18.375 rounded to the nearest tenth?

Respuesta :

rmow1420 rmow1420

17-11-2020

Answer:

18.4

Step-by-step explanation:

Answer Link

fmudiwa2 fmudiwa2

17-11-2020

18.4

Explanation: 35 rounds up to 4 so it would be 18.4 pls mark brainliest

Answer Link

Otras preguntas

Which of the following will occur as the speed of the molecules in a substance increases? a) The substance will become cooler. b) The substance will begin to ta

What type of angle is angle M? A. Acute B. Right C. Straight D. Obtuse

a what model might include a drawing or a three-dimensional object.

What did the Church represent for the common man? during the middle ages

what is the 11/12+(−71/2)

How did the Puritans influence the development of the Massachusetts Bay Colony? They made sure that the traditions of the Church of England continued in the col

In Pasteur's experiments, why didn't bacteria grow in the long necked flask?

Farmer Jones has a problem with his field. Acid rain has made it too acidic. What type of substance should he add to neutralise the acid?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

I am to lazy to write this so somebody answer these please "What is photosynthesis?" (1 -2 sentences) "What is cellular respiration?" (1-2 sentences) "What are

ACCESS MORE