pattersonbrady75 pattersonbrady75

17-11-2020
Business

contestada

One of the last items in an order of business is A. new business B. officer reports C. reading the minutes D. treasurer's report

Respuesta :

Ilovemusic14 Ilovemusic14

17-11-2020

I believe it’s A! I’m not sure though, so I’m sorry if it’s incorrect. It’s just that that one makes more sense!

Answer Link

Otras preguntas

list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

Nutrients classified as "organic molecules" have a molecular structure which contains the element

Express 423 base 5 as a number in base eight

To fund operations so far bill has taken out a second mortgage on his personal residence for $70,000 and deposited the full amount into the company's bank accou

Which is a helpful way to narrow a topic for a research paper? Skin and scan use a web diagram use note cards look for repeated ideas while researching

Circle a has a radius of 3 and circle b has a radius of 11. if the idstance between the center of the circles in 17, find the length of the common external tang

In French, describe the town in the image. Write at least four sentences. Include where things are located in relation to one another (to the left of/to the rig

Most of Australia's population lives in which part of the continent? south west central coastal

Which type of preparations should be patted onto the skin rather than rubbed in?

Name the three bases (left to right) of the mrna codon on the ribosome. predict which trna anticodon will "dock" with the mrna codon.

ACCESS MORE EDU ACCESS