castanluna88 castanluna88

16-11-2020
History

contestada

what're five different causes of the american revolution??

Respuesta :

kothwalp kothwalp

16-11-2020

Causes

The founding of the colonies

French and Indian war

taxes, laws, and more taxes

protests in Boston

intolerable acts

Boston blockade

growing unity among the colonies

first continental Congress

Answer Link

Otras preguntas

Lauren and Aidan left their offices at 6:15 p.m. and drove to meet at a restaurant the same distance away from their offices for dinner. Lauren drove at a const

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Which of the following describes the line graphed below? A:has a slope of 5/2 and passes through the point (0, -2) B:has a slope of 2/5 and passes through the p

SMART PPL PLEASE HELP

What role did the United States play in fighting in the Pacific during World War II?

If Asher plays each of the remaining seasons for which he is eligible, what is the average number of doubles he needs to hit per year in order to match the leag

the sector is engaged in providing services to individual consumers and businesses

I am very confused about this

I got black, I got white, what you want? Hop outside a Ghost and hop up in a Phantom I know I'm 'bout to blow-oh-woah-oh, I ain't d////u//////mb They try to tak

dont answer if u dont like young m.a. only answer if you like her and if u like x. lets talk about them ight?