unicorns231 unicorns231
  • 03-11-2020
  • English
contestada

What is ironic about the attitudes of the rioters and the old man
toward Death?

Respuesta :

cb8887649
cb8887649 cb8887649
  • 03-11-2020

Answer: Most people seek to avoid death, but the old man looks for it. b. He has seen death more than once. c. He refers to his grave as his "mother." d. Most people refer to death as an event not a person.

Explanation:

Answer Link

Otras preguntas

What is the value of x in the diagram below? If necessary, round your answer to the nearest tenth of a unit. 14 х B L D с 30 O A. 30.1 B. 6.5 C. 14 O D. 16
Origina DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT mRNA: AAS: Mutation 1 DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTC
Lucia spends much time outdoors and has developed freckles on her skin. How can she best prevent more freckles from appearing? by applying sunscreen with a high
How would you teach something you have learned this year in Math to someone younger than you? Write more than 5 sentences
Justin is a new manager with 27 direct reports. He has been feeling overwhelmed at work and just learned that the last three managers who held his position quit
HELP ASAP!!! 4.) How can you use a number to explain what an integer and a rational number are?
According to the graph what is the value of the constant in the equation below A. 60 B.15 C.72 D.30
Why is trial by jury considered an essential right?
Heyyy , help maybe please and thanks
A package of 3 pairs of insulated gloves costs ​23.07$. What is the unit price of the pairs of ​?