Hii2007
Hii2007 Hii2007
  • 03-11-2020
  • Mathematics
contestada

PLEASE Please answer ASAP!!! :)

PLEASE Please answer ASAP class=

Respuesta :

Gal20208
Gal20208 Gal20208
  • 03-11-2020

Answer: No it is not.

Step-by-step explanation: A rational number is a number that can easily be expressed as a fraction or decimal, and square root of 7 cannot be easily expressed.

Answer Link
Аноним Аноним
  • 03-11-2020

Answer:

No

Step-by-step explanation:

7 is a prime number It is an irrational number. -It has no square factors and it's square root cannot be simplified.

Answer Link

Otras preguntas

Which process allows organisms to keep internal conditions relatively constant despite changes in external conditions? Homeostasis Hibernation Hypothermia
True or false: the teacher expectancy effect occurs when a teacher s curriculum has subtle ideas that support social control.
25/10 in simplest form
Select the best definition for this combination of word parts. hydro and meter
what is the connection between a man like mungo park and imperialism?
the Bill of Rights was written to protect the rights of
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
rachel jogged along a trail that was 1/4 of a mile long. She jogged along the trail 8 times. how many miles did rachel jog?
the term suffrage refers to
name a pair of lines that apear to be parallel