nairachichi1
nairachichi1 nairachichi1
  • 29-10-2020
  • Mathematics
contestada

find the angle in the question .
I need your help people ​

find the angle in the question I need your help people class=

Respuesta :

felixkings
felixkings felixkings
  • 29-10-2020

Answer:

[tex]\theta = 45.[/tex]

Step-by-step explanation:

[tex]applying \: the \: tingle \: rule : \\ \angle( \theta) = 45. \\ this \: is \: a \: right \: angle \: triangle \\ \angle( \theta) + 90 \: + the \: other \: unknown \: angle \: = 180 \\ but \: the \: other \: unknown \: angle \: =\angle( \theta) \\ 2\theta = 180 - 90 \\ 2\theta = 90 \\ \theta = 45.[/tex]

♨Rage♨

Answer Link

Otras preguntas

What is the main action and reaction forces at work when a person leans against a car? * 3 points A. The person pushes against the car and the car pushes back B
________________ introduced an approach to management known as scientific management. select one: a. chester barnard b. max weber c. henry gantt d. frank and li
In the u.s.all financial institutions are required to conduct business at a physical location only
what is the mrna of tacgggcctatacgctactactggatc​
The sum of four numbers is 20 and their average is 5. When a fifth is added, the new average is 6. What is the fifth number?
describe Poe’s requirements for the short story genre.
a. I, III, II b. II, I, III c. II, III, I d. III, I, II
in a church, the ratio of adults to children is 6 to 11. if there are 306 people in the church, how many children are there?
PLS HELP!!! :(( need a good grade
Why is it correct to say that these two lines have the same meter