Fluttereye16 Fluttereye16

19-10-2020
Mathematics

contestada

What is the equation of a line that contains the points (2,-2) and (0, -2)? y = 0
x=-2
y = -2
x=0

Respuesta :

elibirdzoo elibirdzoo

19-10-2020

Y=-2 should be the answer

Answer Link

dogsavage111 dogsavage111

17-02-2021

Answer:

Y=-2

Step-by-step explanation:

Answer Link

Otras preguntas

Which of these is not a function of money?

T/F: Buyers of a particular new car model are being offered zero-percent financing. This is an example of a promotional allowance.

In 1774, what did the Continental Congress decide to do if British troops used force against the colonies? A.Buy British goods B.Fight back together C.Pay ext

an astronaut drops a rock from the top of a crater on the moon when the rock is halfwat down to the bottom of the crater its speed is what fraction of its cinal

Peter Lacy (placy) has taken an extended leave from the company for personal reasons. However, he was working on a critical project code named White Horse with

Use complete sentences to explain how an enzyme helps an organism. Use the words: reaction and energy

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

A flat sheet of paper is dropped from the top of a building. Assume the force exerted on the paper by the Earth is the same strength as the force from the drag

Formaldehyde is a substance made up of three different types of atoms that are chemically combined in a fixed ratio. As which type of matter is formaldehyde cor

(c) How will an increase in government spending financed by borrowing affect national savings?