sarhat2006at sarhat2006at

01-10-2020
Mathematics

contestada

The length of a rectangular frame is 12 inches, and the width of the frame is 5
inches. What is the length of a diagonal of this frame in inches?

Respuesta :

Аноним Аноним

01-10-2020

Answer:

17 inches

Step-by-step explanation:

Answer Link

Otras preguntas

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?

punctuated equilibrium definition biology

Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?

N the world's lowest-income nations, two in ten children born die by the age of

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?

How did japan gain territory and control of areas of china during world war 1?