feelsafe2007 feelsafe2007

30-09-2020
Social Studies

contestada

HURRRY PLS The construction of__ is an efficient way of making more electricity to benefit humans.

That's the legit size of the box ∠°↔°∫

Respuesta :

mpaulk2025 mpaulk2025

09-10-2020

Answer:

The construction of hydroelectric power is an efficient way of making more electricity to benefit humans. The construction of hydroelectric power is an efficient way of making more electricity to benefit humans.

Explanation:

Answer Link

Otras preguntas

Geometry edulastic question

A flour manufacturer is more likely to use process costing than job-order costing whereas a manufacturer of customized leather jackets is more likely to use job

An man in Arkansas recently found a 9 carat diamond at Crater of Diamonds State Park. Five carats are equivalent to one gram, so this diamond weighs 1.8 g. Di

A light spectrum is formed on the screen using a diffraction grating. The entire apparatus made up of laser, grating and the screen is now immersed in a liquid

This year, Gogo Inc. granted a nonqualified stock option to Mrs. Mill to buy 10,000 shares of Gogo stock for $8 per share for five years. At date of grant, Gogo

The antiviral drug oseltamivir (Tamiflu) blocks the release of the virus from infected cells and must be given within 24-48 hours of infection to be effective a

Aluminum reacts with a certain nonmetallic element to form a compound with the general formula AlX. Element X is a diatomic gas at room temperature. Element X m

What is the difference of the rational expressions below?

A centralização política nas mãos do Monarca (Rei), donde ele, como o poder soberano, decretava as leis, arrecadava impostos bem como organizava os exércitos na

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f

ACCESS MORE