Seudónimo Seudónimo

30-09-2020
Social Studies

contestada

How did Muslim sea traders access India from the Middle East? They sailed south to eastern Asia. They sailed along the Indian Ocean. They sailed along the coast of West Africa. They sailed through the Mediterranean Sea.

Respuesta :

sousceboss sousceboss

13-10-2020

Answer:

They sailed along the Indian Ocean.

Answer Link

EzraGacha1 EzraGacha1

30-10-2020

Answer:

they saild along the Indian ocean

Explanation:

Answer Link

Otras preguntas

Select one: A. ∠T ≅ ∠F B. ∠T ≅ ∠D C. ∠J ≅ ∠F D. ∠J ≅ ∠D

In which of the following graphs is there evidence of correlation AND causation? Graph A Amount of Graph B Water Consumed Amount of Butter Purchased Number of C

Explain how the transcontinental railroad intensified the slavery issue.

Steinberg Corporation and Dietrich Corporation are identical firms except that Dietrich is more levered. Both companies will remain in business for one more yea

Which option is the clearest example of a theme? O A. The story of how the world began O B. Christine destroys her rival, Markus. O C. Love that is forbidden by

A student is getting ready to take an important oral examination and is concerned about the possibility of having an "on" day or an "off" day. He figures that i

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

Solve the equation for t A=s(t+r)x

The more you take, the more you leave behind. What am I? (it's not footsteps)

Which of the following is true for the statement "7 is an odd number"? Question 5 options: A) It's both an open and closed statement. B) It's an open statement.

ACCESS MORE