peytonfarrell
peytonfarrell peytonfarrell
  • 28-09-2020
  • History
contestada

How did the development of permanent settlements change the types of buildings that were needed

Respuesta :

fullrice011
fullrice011 fullrice011
  • 09-01-2021

Explanation:

Settlements required buildings that could hold larger amounts of people for meetings and other gatherings. Settlements were designed with materials that could be taken apart quickly to follow herds in other locations.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Describe these small intestine structures and their functions: intestinal glands -
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
What is let’s read a book in French
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Why were senators able to amass more power and influence than congressmen during the gilded age?
Why did some americans feel that the united states should help europe after world war ii?
Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi
Which tortoises, mainland or island, need to eat more food per gram of their body mass?
Please help me out with this