walkoszgirl walkoszgirl

18-09-2020
Mathematics

contestada

Help can someone do this

Help can someone do this class=

Respuesta :

18-09-2020

Answer:

9x^5-27x^3-21x^2-6x+24

Step-by-step explanation:

you just add similar exponents for x together

9x^5-27x^3-21x^2-6x+24

Answer Link

Otras preguntas

which of the following are necessary when proving that the opposite angles of a parallogram are congruent

At the time "A White Heron" was written, using local color in the writing was popular. Through your reading, which region was the author providing the local co

Which process passes private and sensitive information to unscrupulous websites through clicks on random links?

Over time, some plants growing in an area are crowded out by other plants. The new plants use up water and nutrients needed by the previous plants. The disappea

The declaration complains that women are deprived of the opportunity to protest against unfair conditions. The right to choose their own husbands. Many importan

who was the most notorious gangster in chicago who led the bootlegging industry in the 1920 ?

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

How did World War I affect the economy of the United States?

PLEASE ANSWER + BRAINLIEST!!!!

What philosophy is the belief that everyone has worth and is entitled to respect as a human being? ☐ philosophy of socioeconomic☐ philosophy of individual wo