Manzilthapa Manzilthapa

02-09-2020
Social Studies

contestada

what is society write in a sentence

Respuesta :

mxkaylajade mxkaylajade

02-09-2020

Answer:

society consists of the people and institutions around us, our shared beliefs, and our cultural ideas. Typically, more-advanced societies also share a political authority.

Explanation:

Answer Link

kayleemuller99 kayleemuller99

02-09-2020

a community of people filled with all different kinds of people with different beliefs.

Answer Link

Otras preguntas

__________ is widely considered to be the founder of the professional american police department.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In a survey, a group of students were asked to name their favorite day of the week. There were 8 students who chose “other”. How many students participated? Sa

Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.

A book with 30 pages has 21 pages with printing, 5 pages with printing and pictures, and 4 pages that are blank. What is the theoretical probability of opening

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.

Which of the following are solutions to the equation below? Check all that apply. x2 - 16 = 0

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

Please help me with this one too !!!