ibaabdullaazeem ibaabdullaazeem
  • 29-07-2020
  • Mathematics
contestada

Triangle ABC is isosceles with AB = AC.
Angle BAC = 110° and the area of the triangle is 85cm^2
Calculate AC.

Respuesta :

holcombe345 holcombe345
  • 29-07-2020
Ddddffffffffffffcccggggg
Answer Link
ilizajones14 ilizajones14
  • 29-07-2020

Answer:

22.5 cm

Triangle area is (L x W) / 2

7.5 x 6 = 45

45 / 2 = 22.5

Step-by-step explanation:

brainlist plzzzz

Answer Link

Otras preguntas

The Cotton family purchases a glass sculpture in the shape of a rectangler pyrimad.The base measures 7 1/2 inches by 5 inches.If the volume of the sculpture is
How did fascist government take power in Italy and Germany?
Find the length of a pendulum that oscillates with a frequency of 0.15 Hz.
what is the value of the expression 2 1/4 divided by 1 2/5
what is the mrna of tacgggcctatacgctactactggatc​
Consider the equation log5(x + 5) = x2.What are the approximate solutions of the equation? Check all that apply.
In the following sentence, identify the part of speech of the italicized word. Large fish swim swiftly in the sea. A. Noun B. Adjective C. Adverb D. Verb
How many square feet of outdoor carpet will we need for this hole
Can u guys help me in these questions please.i really need I was trying but I dont really understand...thax
Which set of ordered pairs represents a function?