bwarismendez bwarismendez
  • 27-07-2020
  • Mathematics
contestada

Which expression is equivalent to ? (2^1/2 times 2^3/4)^2

Relax

Respuesta :

DJFIZZ DJFIZZ
  • 05-01-2021

Answer: B or square root 2^5

Step-by-step explanation: I checked on my calculator

Answer Link

Otras preguntas

it is important to put your goals in ... (7)
3. Ann graphed the line below in science class. What is 5 points the y-coordinate when the x-coordinate is 6?* YA 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 1 2 3 4
1/2x-12-48=180 Process of how to find X? please I need the help
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
A rectangle or prism measures 3 1/2 cm long to 2 1/2 cm wide and 1 1/2 cm high how many tubes with side length of 1/2 cm I needed to fill the prism
the radius of a circle is 63 centimeters. what is the circumference of the circle?
How does conflict shape a society
Help pls I don't have time
what is equivalent to: 8c+ 12d +d+ 2c?
DOP Maze. Please fully complete it for me ASAP. The pdf document of it is attached to this post. Thanks!