mrrinse31 mrrinse31

17-06-2020
Mathematics

contestada

Plz need help for a grade god explanation and answer get brainliest

Plz need help for a grade god explanation and answer get brainliest class=

Respuesta :

Wishing Wishing

24-06-2020

Answer:

20%

Step-by-step explanation:

There is a 20% chance you get selected for researching China because 5 out of 25 spaces are ones for researching China.

[tex]\frac{5}{25} =\frac{20}{100}[/tex]

Answer Link

Otras preguntas

Suppose the radius of a circle is 1. What is its circumference? Either enter an exact answer in terms of pi or use 3.14 for pi and enter your answer as a decima

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Which of the following is an example of self-awareness? multiply choice Bob has always had a passion for numbers. Bob is going to become a lawyer. Bob has alway

What number raised to the -2 exponent would equal 1/4?

Sensory neurons carry nerve impulses from the brain and spinal cord to muscles and glands. True or false?

why can iron be used to get copper from copper sulfate solution

Another name for the Counter-Reformation of the 1500s was?

what would a normal human be able to do when having lung cancer?

IQ scores for adults aged 20 to 34 years are normally distributed according to N (110,25). Use the empirical rule to answer the following: Approximately what

In the concentration camps, the people least likely to be executed were a. children. c. the 6iest. b. women. d. the weakest.

RELAXING NOICE