ruban2124 ruban2124

16-06-2020
Mathematics

contestada

(-4) x[15+ (-3)] = (-4) 15+_____________
a)4×(-3)
b)15×(-3)
c) (-4)×(-3)
d)4×3

Respuesta :

JustAnotherSchoolKid JustAnotherSchoolKid

27-05-2021

Answer: C

Step-by-step explanation:

I searched it up. :)

Answer Link

Otras preguntas

Define the soil exhaustion

What is the direction of the electric field at a point directly below a negative charge, Q? up down left right

I’m lost on this question. Help???

Paula, a college student, earned $3,600 one summer. During the following semester, she spent $2,500 for tuition, $650 for rent, and $430 for food. The rest went

list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

What came first: the genetic variation of different beaks or natural selection acting upon them?

W.E.B. DuBois and Booker T. Washington both worked their whole lives for civil rights, but they didn't agree on many things. Which statement best describes thei

How many alleles for black fur are in the sample population and what percentage of allele frequencey does that repersent?

Can someone please simplify this for me? 63 ÷ 3 2 + |2|

I need help with this please