dayoogundipe dayoogundipe

02-06-2020
Chemistry

contestada

What does thermal energy measure?

Respuesta :

TheAnimeGirl TheAnimeGirl

02-06-2020

Hey!!

Here's your answer

Thermal energy is the energy that is generated or measured by heat.

Thermal energy measures the movement of atoms or molecules within a substance.

Hope it helps

Answer Link

Otras preguntas

The Union blockade of the southern coast led to the development of ______ by the Confederate Navy. A)special aircraft B)long range artillery cannons C)ironcla

Select the correct answer. Which description best defines the thesis of an informational text? A. the central point the author is trying to make B. the examples

What should a thesis statement include

The old lady who lived in a shoe is shopping for air fresheners. She finds 6 sock-shaped air fresheners priced at $11.40. Express this as a unit rate. What unit

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

in a(n) ___ trial, the judge hears the evidence without a jury present before making a ruling.

Which of the following is NOT one of the basic functions of the nervous system? Release hormones into the bloodstream the travel around the system blood circula

The graph reflects changes in party identification over time. These changes have had substantial effects on electoral processes. (a) Identify the dominant trend

Help would be greatly appreciated! Which answer best describes the following text? A baseball coach get cut from his community baseball team Situational irony

Describe the unique properties of water and how they affect the following: phase changes physical properties This is my answer. Is it ok? Do you have suggesti