kathleenzaccone kathleenzaccone
  • 01-06-2020
  • Mathematics
contestada

The scale on the map is 1/4 inch=20feet. What is the actual distance if the distance on the map is 48 inches?

Respuesta :

dom1229 dom1229
  • 01-06-2020

Answer: all you need to do is 48 divided by 1/4 and you will get your answer

Step-by-step explanation: hope. this helps

Answer Link

Otras preguntas

Graph the first six terms of a sequence where a1 = -10 and d = 3.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the most common type of vegetation throughout Latin America
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
what rule does static electricity follow
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Please help solve, thanks in advance!
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa