chaseity3 chaseity3
  • 03-05-2020
  • Mathematics
contestada

Please help me solve this problem

Please help me solve this problem class=

Respuesta :

laylaperry3 laylaperry3
  • 03-05-2020

Answer:

-2/3x+6

Step-by-step explanation:

Answer Link
Аноним Аноним
  • 03-05-2020
What they said.................^^^
Answer Link

Otras preguntas

Which amendment to the Constitution gives people the right to petition the government for a redress of grievances? First Amendment Second Amendment Fifth Amendm
sorry to bother you guys, but I'm going to need a lot of help w/ this!
A population of hyenas inhabits a tropical savanna. At the beginning of the year, there were 100 hyenas in the population. Throughout the year, 20 hyenas died,
In point-slope form, write the equation of a line that is perpendicular to the given line and that passes through the given point. Explain how you know it will
In your best writing, showing what you know about ideas and organization, explain how you would organize an essay about the benefits of an electronic portfolio
The directions the Clean- All say to mix 1 1/2 cups of cleaner with 2 quarts of water. The directions for Mega- Clean say to mix 3 1/2 cups of cleaner with 1 ga
What were the political, economic and cultural forces that led to the Walla Walla Treaty? Do you agree with the terms of the treaty and the relocation of native
What was the most common held belief on Social Gospel movement
Solve the inequality. –4s < –8 30 Points for answering correctly
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.