kavinsv2007
kavinsv2007 kavinsv2007
  • 27-03-2020
  • Arts
contestada

if you move a chess piece in the wrong place while holding it can you move it

Respuesta :

abbie705
abbie705 abbie705
  • 27-03-2020

Answer:

Yes

Explanation:

:))))))))))))))))))))

Answer Link
AcrobatRiley
AcrobatRiley AcrobatRiley
  • 27-03-2020

Answer:

Yes because you did not put the piece down yet.

Answer Link

Otras preguntas

What was the name of an ancient written work by the Chinese that included the study of dentistry? A. Canon of Medicine B. The Works of Sir John Tomes C. Hippocr
Since mature red blood cells do not contain a nucleus, more room is available for what?
A study that examines chemical properties A. Chemistry B. Meteorology C. Geology D. Astronomy
Easy! Grammar! Which one is correct? 1. The number of gun deaths in Australia IS very low. 2. The number of gun deaths in Australia ARE very low.
the Atlantic crossing in the slave trade was known as
The scientific name for water spider
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
Six less than five times a number is 29. What is the number?
What is the answer to the following 3-3x6+2=
Which is an example of a periodical? Your Ultimate Computer Guide The Wall Street Journal The Collected Works of Shakespeare The Encyclopedia Britannica