1985estherlopez 1985estherlopez

17-03-2020
Mathematics

contestada

Write the sentence as an equation.

19 increased by d is 234

Respuesta :

JoyMark JoyMark

17-03-2020

Answer:

19+d=234

Step-by-step explanation:

"increased by d" is addition. "is" is equal. So Putting these together it would be 19+d=234.

Hope this helped!

Answer Link

Otras preguntas

The the flourishing of a vibrant black culture in the 1920s in new york city, called _____, was inspired by countee cullen, langston hughes, and claude mckay.

With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

It takes 10 workers 24 hours to do a job. Fill in the chart.

How is the creation of public policy in Russia different from that in the United States?

What is the elapsed time

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

During translation, the mrna is read in groups of three bases. true false

What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h