aguilaradrian46
aguilaradrian46 aguilaradrian46
  • 02-03-2020
  • Health
contestada

when setting your schedule, it is sometimes neccessary to tell people "No"
True
False?​

Respuesta :

mmaher
mmaher mmaher
  • 02-03-2020

Answer:

I'd say true

Explanation:

because sometimes you have a date you cant move so if there's a less important date to add so you have to say no or something like that hope its helpful

Answer Link

Otras preguntas

pls help me! this is slope and i still dont get it
Which of the following is a common physical property of ionic compounds? A. high melting point B. insoluble in water C. conduct electricity when solid
How might the war have turned out differently if that battle had been lost?
A table that originally cost $196 is on sale for $160.00 what is the percent of decrease rounded to the nearest tenth ?
Alice is paying her bill at a restaurant. The tax on the cost of her meal is 5%. She decides to leave a tip of 20% of the cost of the meal plus tax. Write an ex
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
Rick’s class plans to study the effect of eating different breakfast foods on grades in morning classes. Students in the class will be the test subjects for the
Choose the best way to punctuate the sentence. We ate steak ____ baked potatoes ___ and corn for dinner last night. A) We ate steak. Baked potatoes, and corn
Carl is boarding a plane. He has 2 checked bags of equal weight and a backpack that weighs 4kg The total weight of Carl's baggage is 35kg
Carrie has 32 ounces of ice cream to divide equally among 10 people.How much ice cream will each person get