jdogaming03 jdogaming03

27-02-2020
Health

contestada

Which pair is more closely related?
A. mammals and crocodilians
B. turtles and mammals
C. pterosaurs and turtles
D. crocodilians and pterosaurs

Respuesta :

milesbaby108 milesbaby108

27-02-2020

The answer is A because it’s right

Answer Link

Otras preguntas

Drag each equation to show if it could be a correct first step to solving the equation 2(x + 7) = 36. A 2x + 14 = 36 B (2 • x) + (2 • 7) = 36 C 2x + 7

Justin opened a savings account with $500. He plans to save $50 per week from his paycheck. Which equation would represent his total balance, y, after x weeks

how to factor 15x-7x-2

The time taken to prepare the envelopes to mail a weekly report to all executives in a company has a normal distribution, with a mean of 35 minutes and a standa

A team of engineers at General Motors is in charge of discovering new knowledge that can be used to make automobiles safer and more economical. These engineers

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

plss help asap due rn i will do brainliest tooo pls and tyyyyyyyyy

In the world around you, if you wanted to create some instruments from items you have around the house or in your neighborhood, how would you make them? Describ

The president does not want to change the selling price. Instead, he wants to increase the sales commission by $1.50 per unit. He thinks that this move, combine

Mike used to really enjoy potato salad, and at a family reunion he ate a large helping. Unfortunately, the potato salad had not been properly refrigerated, and

ACCESS MORE EDU ACCESS