larvick40 larvick40

17-02-2020
Mathematics

contestada

Simplify the following expression 7d-9-6d-4

Respuesta :

gufeliz1965 gufeliz1965

17-02-2020

See picture for answer.

Ver imagen gufeliz1965

Answer Link

animalsarecute animalsarecute

17-02-2020

Answer:

d-13

Step-by-step explanation:

We can simplify variables then numbers:

7d - 9 - 6d - 4.

7d - 6d - 9 - 4

d - 9 - 4

d - 13

Answer Link

Otras preguntas

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Suppose two individuals, one from suburbia and the other from the inner city, showed the same patter of aggressive and paranoid behavior. In diagnosing these tw

jontae went to brunch with his family and offered to pay the bill.The total bill was $54.19 before tax. If there is a 15% how much does he pay in taxes

Check the item that is not one of the four kinds of misplaced modifiers studied in this section. absolute modifiers improperly placed adverbs split infinitiv

If the standard to produce a given amount of product is 500 direct labor hours at $15 and the actual direct labor incurred $600 at $17 direct labor rate varianc

Select the correct answer. How does the author develop the character in this excerpt? A. through the character's thoughts B. through the character's language C.

Solve these following equations A.3÷25.50= B. 8÷1.624= C.7 ÷21.56= D.5 ÷1.005

PLEASE HELP Consider the mass spectrum (graph) for zirconium and answer the questions below. 1. Which isotope is most abundant? 2. Which isotope is least abund

What was the final result of the debate over secession in Georgia? A. Georgia declared itself an independent nation. B. Georgia remained in the Union (U.S.A.).

The term performance quality refers to: Multiple Choice Customer satisfaction with the total experience of a product or service. The gap between product design

ACCESS MORE