whywolveshowl whywolveshowl

18-10-2019
History

contestada

hey i need some help but brainly wont let me post them so im gonna put it in the ask for details

Respuesta :

18-10-2019

Answer: I believe it was Anne Hutchinson

Please give brainliest if im right

Answer Link

Harleycora Harleycora

18-10-2019

Answer:

its David Hoadley

Explanation:

Answer Link

Otras preguntas

The_____ form acidic compounds with hydrogen.

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.

what does the constitution state about the interaction of the judicial branch and new laws

how did white supremacists provide support for the ku klux klan

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge

What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?