debbie01132 debbie01132

29-09-2014
Mathematics

contestada

How do you work out the sum 8.54 divided by 62

Respuesta :

hillmatthew699 hillmatthew699

29-09-2014

take out the decimal point. times them together and then add the decimal point, making sure you've got the same amount of decimal places that you started off with

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which hydrocarbon can have cis-trans isomers?

B. What communication strategies would you use to communicate with someone from a diverse culture

Who would pay more in state income taxes? Both Jamal and Diamond decide to buy a new computer at a store near their homes. The computer costs $500. Who will end

which famous female psychologist completed all of the requirements for a doctorate in psychology but was denied that degree because of her sex?

Corrine has 4.2 pounds of trail mix to divide into 14 bags. How many pounds of trail mix will go in each bag? Each bag of trail mix will contain pounds of trail

Part B Substitute 5, 3.4, and 41 into the equation from question 1, part A. Which of these values result in a valid equation?

complete by till or stillWe must take a decision ................ Tuesday.

Did the framers of the Constitution want a strong (big) federal government or a weak (small) federal government? Use THEIR WORDS (in the Declaration of Indepen

3. You have $20 to spend at the snack bar. All of the snacks at the snack bar cost $1.25. How much money will you have left if you buy: a. 2 snacks? b. 7 snacks