Breannaaaaa
Breannaaaaa Breannaaaaa
  • 17-05-2016
  • Mathematics
contestada

What is the value of 7P3

Respuesta :

Аноним Аноним
  • 17-05-2016
7P3= 7!/(7-3)!
= 7!/4!
= 7*6*5
= 210

C.210
Answer Link

Otras preguntas

A student is conducting an experiment to determine how far a ball will roll down a ramp based on the angle of incline. What are the independent and dependent
If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?
A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the
Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th
Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F
Write about the formation of Himalayas
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?