suyanavassor suyanavassor
  • 01-12-2018
  • Mathematics
contestada

how do you subtract 3/4-3/8 using simplest form

Respuesta :

jconst06
jconst06 jconst06
  • 01-12-2018

Answer:

Hello there, I love answering these questions!

Step-by-step explanation: turn 3/4 into 6/8 = 3x2/4x2 then subtract. 6/8 - 3/8 = 3/8

Hope this helped you! Have a wonderful day!


Answer Link

Otras preguntas

On which river did Kush develop?
Write an equivalent decimal, fraction, or mixed number for 3.2
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
Yolanda needs 5 pounds of ground beef to make lasagna for a family reunion. One package of ground beef weighs 2 1/2 pounds. another package weighs 2 3/5 pounds.
_____ is the closest relative to modern humans. Cro-Magnon Homo erectus Neanderthals
What is the part of speech of the underlined phrase in the sentence below? Is the jacket on the couch yours or mine? (on the couch)underlined Question 14 option
The shape of Oklahoma can be divided into 2 perfect rectangles and 1 triangle. About how many square miles does Oklahoma cover
What distinguishes a hypothesis from a theory? A. A theory is a scientific explanation. B. A theory is testable. C. A theory explains a natural phenomenon. D. A
how many times shorter is one foot then one yard
Kalvin tosses a coin five days in a row and gets tails everytime.Do you think there is something wrong with the coin? How can you find out?