andrew12367 andrew12367
  • 02-11-2018
  • Mathematics
contestada

What is 2÷39 I'm really confused
on this?

Respuesta :

alananicolelatham34 alananicolelatham34
  • 02-11-2018
.05 is the answer unless u flipped them which is 19.5
Answer Link
iwillrektyou
iwillrektyou iwillrektyou
  • 02-11-2018

Answer:

The answer is 0.05128.

Step-by-step explanation:


Answer Link

Otras preguntas

(5x-4) (3x+2) multiply
Slope = 2 passing through (6,2)
Please help. The question is in the attached image.
What is the slope of a line that passes through the points (6, 5) and (12, -3)
What is the differnce between bonded and unbonded pairs?
A child has a box of candies which might have a toy inside . The odds against the box having toys are 6/7 . What is the probability of the box having a toy ?
Hurrryy!!!!!!!!Bacon lists Cupid’s attributes in order to show that Cupid is real. prove that Cupid is a child. disprove the existence of the atom. compare them
A(n) _______________________ provides a quantitative description of trends, attitudes, and opinions of a population, or tests for associations among variables
When a number is tripled,the results is -33
Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA a. What DNA sequence would encode for this mRNA? Provide the sequence in form (single-or doublestrand