ishanijafar247 ishanijafar247

27-10-2018
English

contestada

I need the justification. please help me.

I need the justification please help me class=

I need the justification please help me class=

Respuesta :

meaganspratlan meaganspratlan

27-10-2018

In my opinion I think the 5 one down should be agres

Answer Link

kaysimon17 kaysimon17

27-10-2018

I would say 3rd down would be agree

Answer Link

Otras preguntas

you start at (0,5) you move up 1 unit . where do u end

The surface area of a right rectangular prism is 2f + 2t + 2r, where fis thearea of the front face, t is the area of the top face, and r is the area of theright

Which 2 terms are multiplied in the continuity equation to determine cross-sectional area?.

As Sara rode her bike at 13 mph, how many feet did she travel in 16 seconds? (1 mi =5280 ft)Round your answer to the nearest tenth.Do not include a unit of meas

Which expressions are equivalent to the one below? Check all that apply.A.B.C.4xD.4E.16xF.(16 - 4)x

Pls help I need help with b directions : find the measure of angle b explain the geometric relationship that helped you determine the measure of angle b

Last week at a festival, a man sold 4 times as many tie-dyed t-shirts as silk screened shirts. He sold 180 shirts all together. How many tie-dyed shirts did he

The mRNA produced by the transcription of a gene encoding an oligopeptide is: 5 'AAAUGAAACCAGGAUAAGAAUU3' while the peptide produced by the translation of the a

How were Indigenous groups in the new nation affected by the end of the Revolutionary War?

When first observed an all steel covers 2 mi.² measurement shows that the area is tripleling every eight hours find the exponential model for the area a (in mi^