megan21423 megan21423
  • 30-09-2018
  • Mathematics
contestada

Find m
A. 12

B. 22

C. 52

D. 38

Find m A 12 B 22 C 52 D 38 class=

Respuesta :

morganmaenash
morganmaenash morganmaenash
  • 30-09-2018

C. 52

Work:

(5x - 22) + (4x + 4) = 90

9x - 18 = 90

9x = 108

x = 12

4(12) + 4 =

48 + 4 = 52

Answer Link

Otras preguntas

A small block of mass 20.0 grams is moving to the right on a horizontal frictionless surface with a speed of 0.540 m/s. The block has a head-on elastic collisio
What is the approximate distance between two points (3,5) and (-4,-8)
If A={3,6,9,12 }and B={0,4,8,12}, then find A∩B. *​
A force of 10 newtons is acting upon a box. If the box is not moving, we can assume-
​% of U.S. adults have very little confidence in newspapers. You randomly select 10 U.S. adults. Find the probability that the number of U.S. adults who have ve
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
Which statement is true about lines a and b?
what is (9c/-9)/-3 in simplified form​
20 POINTS !! PLEASE ANSWER THIS QUESTION !!
Jayne stopped to get gas before going on a road trip. The tank already had 4 gallons of gas in it. Which equation relates the total amount of gasoline in the ta