nhughes38 nhughes38
  • 18-09-2018
  • Physics
contestada

what the sum of x and it's square is equal to y times z.

Respuesta :

s1m1
s1m1 s1m1
  • 18-09-2018
Translation into algebra
X+ x^2 = yz

X^2+ x-yz= 0
Answer Link

Otras preguntas

Can i please get a summary ( a short explanation) of chapter 2 of to kill a mocking bird .
how did the first texans adapt after the end of the ice age?
and passes Write the equation of the line that has a slope of 5 through (15, -3).
Which is an example of using credit? O A Consumer buys an item and pays by check. A consumer buys an item and promises to pay later. O A Consumer buys a share i
What is the answer Timothy curtain company is making curtains for a local hotel he wants each certain to be 48 inches long at the fabric store from Vegas sold b
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
can someone help me find the answer?
If a hot air balloon takes off from an elevation of 1,800 feet above sea level and climbs at a constant rate of 34 feet per minute, then the altitude of the bal
One exterior angle for a regular hexagon is
Helium gas is compressed by an adiabatic compressor from an initial state of 14 psia and 50°F to a final temperature of 320°F in a reversible manner. Determine
ACCESS MORE