aubwalka aubwalka
  • 16-03-2016
  • Biology
contestada

what is the principle called the conversation of matter

Relax

Respuesta :

NerdyBird
NerdyBird NerdyBird
  • 16-03-2016
the conservation of matter is when matter cannot be created or destroyed.
Answer Link

Otras preguntas

define intrinsic motivation
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.
When the net is folded into the rectangular prism shown beside it, which letters will be on the front and back of the rectangular prism? Question 7 options: The
How many significant figures are there is the numerical value: 0.00019?
Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1
Explain the translation process that results in production of a polypeptide
What is the lowest level of measurement that a median can be computed?
PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The introduction of the Green Revolution in India was intended to