bunnylover2421 bunnylover2421

30-08-2018
Mathematics

contestada

how many apple will be in 6 tree's if there are 219 in each tree

Respuesta :

30-08-2018

In this problem, you just have to multiply 6 and 219.
So, 6x219=1314
So your answer is 1,314

Answer Link

Аноним Аноним

30-08-2018

1,314 IS Your answer

Answer Link

Otras preguntas

List three powers congress had and tell why each was important

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for theme template strand above. What would the mRNA be based upon the template strand above?

(04.04 MC) Which of the following substances is released during the light-dependent reactions of photosynthesis? (4 points) Carbon dioxide Oxygen Wat

Which statement describes and advantage of nonrenewable resources? A. They produce clean energy B. They replenish quickly C. They are safe for the environment D

3. [3.04] Describe a process for finding the measure of angle 2.

what did Eisenhower do with New Deal programs?

How many number of electron shells does calcium have ?

Mason is cutting wood for a carpentry project his bossis completing. He has been given boards which are 72 inches long, but he needs them to be 20 percent of th

which function best represents the data below

What is the slope intercept from the liner equation 2x+3y=6

ACCESS MORE