henleysheridonpb1jqh henleysheridonpb1jqh

28-06-2018
Mathematics

contestada

R: {(−4, 8), (8, 10), (5, 4), (1, 6), (5, −9)}

Respuesta :

Аноним Аноним

28-06-2018

The range is

r: {-9,4,6,8, 10}

hope this helpsss

Answer Link

Otras preguntas

Graph the function f(x)=32x−4. Use the line tool and select two points to graph.

Help please! What is the mass of the iron (Fe) involved in this reaction? Identify the following equations as balanced or unbalanced (4 questions) Will give bra

Multiple Questions, Brainliest and 98 points to whoever answers all questions correctly

High SchoolHistory 5 points Which factor most influenced the construction of semi permanent settlements during the neolithic period

Children walking on the sidewalk a person sitting in a parked car in a parking lot with vehicle entering and existing indicates a

Thousands of amendments to the Constitution have been proposed. Why do you think only 27 formal amendments have been added to the Constitution

I know it's messy but can someone let me know if this was right? It's asking for the distance from point (-3,-7) to line 5x+4y=39

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for theme template strand above. What would the mRNA be based upon the template strand above?

2. Íbamos a la playa. Empareja las siguientes frases de manera que formen oraciones correctas y lógicas.

please.. this is due by midnight and i’m close to tears.. from a point in a straight road, Chris and Elena ride bicycles in the same direction. Chris rides at 1