TayTay4343 TayTay4343
  • 19-06-2018
  • History
contestada

What is a laissez-faire government?

Respuesta :

campsyd2
campsyd2 campsyd2
  • 19-06-2018
An economic system in which transactions between private parties are free from government intervention such as regulation, privileges, tariffs and subsidies.
Answer Link
jakefsnow
jakefsnow jakefsnow
  • 07-01-2020

Answer:

A government that does not interfere with the economy

Answer Link

Otras preguntas

What is the molarity of a solution that contains 17g of NH₃ in 0.50L of solution? Please explain as well!
Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f
Find the center and radius of the circle (x + 1)^2 + y^2 = 4
At what age do babies learn to crawl? Does it take longer to learn in the winter when babies are often bundled in clothes that restrict their movement? Data wer
Name the animals having eye in stomach?​
Please help me find which expression is correct
13. A recent survey by the cancer society has shown that the probability that someone is a smoker is P(S) = 0.31. They have also determined that the probability
How far can a cyclist travel in 2.5h along a straight road if her average speed is 18km/h? A. 45km B. 7.2km C. 45m D. 7.2m
During which element of plot can the result of the conflict be predicted?
What are the restrictions on the domain of the following function? f(x)=x-3/(x-3)(x-4)(x-5)