lawxloch lawxloch

28-02-2016
Mathematics

contestada

is 52 a multiple of 4

Respuesta :

nadrzewopierwsza nadrzewopierwsza

28-02-2016

ANSWER: Yes, because 52:4 = 13

Answer Link

Otras preguntas

A verb phrase consists of A. the main verb only B. the main verb and any helping verbs C. the main verb, any helping verbs, and any adverbs D. helping verbs onl

I need help is it A B C or D

What is the advantage of having a folded inner membrane in the mitochondria?

a television game show has 6 doors, of which the contestant must pick 2. Behind 2 of the doors ate expensive cars, and behind the other 4 doors are consolation

what economic system where the factors of production are privately owned?

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

How many quarters can fill a 2 liter bottle?

Juliet is being tested for a contagious disease. The test is 99% accurate and in actuality 0.1% of the population has the disease. Juliet still thinks she has t

Mark got 18 out of 25 questions correct on his science test. What percent of the questions did he get right?

Solve for n. n+4+10=25n+4+10=25

ACCESS MORE