chafincole chafincole
  • 28-03-2024
  • Biology
contestada

CTGTTACTTTCAATCGTACACCAACACTGCTTTC
Translate and transcribe this strand of DNA into mRNA and amino acids.

Respuesta :

Otras preguntas

Triangle ABC has vertices at A(-2,3),B(-3,-6), and C(2,-1). Is triangle ABC a right triangle? If so, which angle is the right angle? O No, the triangle has no r
how does sodium metal conduct electricity?
À partir d’un exemple, expliquez l’origine de la diversité génétique au sein d’une espèce.
Which of the following are non-modifiable risk factors for coronary heart disease? Check all that apply.a. Family history b. Low blood HDL c. Physical inactivit
Performance drama has changed a lot since Ancient Greece and Shakespeare. What is one of the most significant ways it has changed?
fill in the blanks with suitable prepositions to complete the para given below
PLEASE HELP GIVING BRAINLIEST IF CORRECT AND ANSWERS ALL!!!!! The Harlem Renaissance was a period of great artistic expression in the black community. Consider
what is a raven?.....​
How much radiaton does a modern day phone have?+does it harm the human body?​
Match each prefix with its definition.Match Term DefinitionAnti A) PartlyMulti B) AgainstSemi C) Many
ACCESS MORE
EDU ACCESS
Universidad de Mexico