farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

I need help with number 3 who can help me

There are several different assays to detect the products of digestive enzymes (hydrolases). since chemical changes cannot be seen with the naked eye, these ass

How many grams are in 3.01 x 10^23 atoms of carbon?

What is the science of describing naming and classifying organisms?

How often should you apply an ice pack to an injured leg? Question 18 options: Every hour for 5 minutes at a time for the first 36 hours. Every 5–6 hours for 10

Hewlett-packard's recycling service for computers and printers is available today in more than 73 countries, regions, and territories. hewlett-packard has recyc

What is shown in the image A. Prokaryote B. Eukayote C. Chloroplast D. Mitochondrion

This political ideology is associated with the Republican Party in the United States.

Which social class do you think you belong to? Why? Who are your peers? In your everyday choices, whom do you tend to take as a reference point? Your peers? Oth

What events brought about the rise of the ottomans ?

ACCESS MORE