sernaramonserna sernaramonserna

30-01-2024
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

Otras preguntas

ILL GIVE BRAINIEST Write the equation of the line in point-slope form using the indicated point. The equation of the line is

gated channels for sodium ions may include gated channels for sodium ions may include chemical gates, which respond to ligands. mechanical gates, which respond

the benefits of economies of scale and increased competition to an economy include lower unit costs.

cartilaginous fish (chondrichthyes): have a swim bladder. have teeth mineralized by calcium phosphate. are generally freshwater species. have well-developed kid

sarah has been recruited as the science teacher at carlson middle school. identify the communication style that sarah should adopt to ensure that she communicat

a legal citation for a court decision is used by legal professionals to research the law, and includes:

Question: 22-w >4,w=11 Can some one help please

the main point of contention between the pennsylvania system and the new york system was the question of

before becoming pregnant, a woman's heart rate averaged 72 beats per minute. the woman is now 15 weeks' pregnant. the nurse would expect this woman's heart rate

Evaluate. Remember Order of Operations! (PEMDAS) 32 +21 ÷ 3

ACCESS MORE