sharidler sharidler
  • 16-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?​

Respuesta :

Otras preguntas

100 points!!!!! answer only if known Two objects collide and bounce apart. Assuming no outside forces act on the system, which best describes the total momentum
Which equation has no solution? A). 24x + 32 − 2.1x = 20.9x + 30 + x + 2 B). 24x + 32 − 2.1x = 20.9x + 30 + x − 2 C). 24x + 32 − 2x = 20.9x + 30 + x − 2 D).
What was the most costly war for the us
Terza rima, which has three lines per stanza, was created by _____.
i need more info on the medieval era not the same thing
The sum of the digits of a two-digit is 7. When the digits are reversed, the number is increased by 27. Find the number. Show your work.
Earth’s first life forms were __________. aerobic cyanobacteria photosynthetic chemoautotrophs
Simplify (3x + 5) + (2x - 9) - (4x + 3).
Which of the following is not true about effective drug abuse treatment? (1 point) patients should be monitored for continued drug use. medications should never
Excess fat, whether saturated or unsaturated, is stored as.
ACCESS MORE