jaidenlaine827 jaidenlaine827

29-11-2022
Biology

contestada

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?
GTAAGCTTCGACAAGCTTGCTGA

Respuesta :

Otras preguntas

What effect does the use of capital letters have on a search? Using all caps will always give you more results than searching without capital letters.

What is the empirical formula of ascorbic acid, given that the pseudoformula is C3.407 H4.53 O3.406??

What characteristic does ancient India share with other civilizations, such as the Egyptians, Mesopotamian, and Chinese?

How many states are needed to ratify an amendment to the constitution?

World war ii began with the german invasion of _____. russia luxemburg poland france

How do I solve the two step equation 4(x+8)=44

At the end of the American Revolution, Great Britain gave up territory east of the Mississippi River. kept territory east of the Mississippi River. took control

What 2 numbers add to 17 and multiply to -168?

Give an example of a predator-prey relationship. Then, identify the predator and prey.

I need help please enyone

ACCESS MORE EDU ACCESS