paavanan79 paavanan79
  • 29-09-2022
  • Computers and Technology
contestada

If A1 :A5 contain the numbers 16 10 3 25 and 6 then =average (A1:A5;60) will display what

Respuesta :

Otras preguntas

Johanna Springer, who works as a sales executive at Pascal's Bank, is upset at the way her manager, Emma Womack, always calls her in for one-on-one meetings to
Corrine wrote temperatures in degrees Celsius and the equivalent temperatures in degrees Fahrenheit. Equivalent Temperatures Celsius –10 5 10 20 Fahrenheit 14 4
Which of the following statements is not true regarding bases? (3 points) Ammonia (NH3) and Pyridine (C5H5N) are weak bases. Bases have a pH greater than 7. Str
A company that uses the perpetual inventory system sold goods to a customer on account for $ 2,100. The cost of the goods sold was $ 1,050. Which of the followi
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
what is the value of b in the 5^6/5^2=a^b
Long wavy is it Dominant or recessive
Mr. Gregg wants to help his second-grade students improve their reading skills. He tests the students with 20 reading comprehension questions at the beginning o
1. How might a specific location on Earth be found using absolute location, as well as relative location?(absolute location, relative location)​
ok, I need help with this one!!!!!!!!!!!!!!!!!!!! plz and thank you Which statement is a correctly written thermochemical equation? 2C8H18 + 25O2 →16CO2  + 18H2